rs41443951 chr2:101972951 C>A
- Sequence
atgactaaaaacagcagtgagaac[C/A]attgcaacacaaaaacttcctgaa
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) monocyte-derived macrophages from peripheral blood MDM(monocyte derived macrophages) macrophages
- ASB for transcription factors
- SPI1_HUMAN E2F8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.38 | 0.61 | 1.72 | n/a | No Hit | |||
| E2F8_HUMAN | 1.78 | -0.51 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2