rs414909 chr1:4778181 C>T
- Sequence
aggcagcagagggcagaatttatc[C/T]cagatcccgatctggaagatggct
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) CD34+ hematopoietic stem cells-derived proerythroblasts OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.93 | 0.86 | 1.28 | n/a | No Hit | |||
| GATA1_HUMAN | -3.88 | 1.42 | 2.00 | 3.68 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
