rs41514951 chr19:54478884 A>C
- Sequence
ggaccacaagagggcactcaagat[A/C]cgtgtcaaacccttgaagccccaa
- ASB in cell types
- erythroid cells CD20+
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.46 | n/a | 2.00 | |||
| CD20+ | 2.79 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Nerve_Tibial, Stomach, Thyroid, Whole_Blood