rs41537545 chr18:70289064 G>A
- Sequence
gcggcagtcgcgccggcgctgggc[G/A]aggaagcggagccgggccgcctcc
- ASB in cell types
- SUM159PT (Triple negative breast cancer) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | -0.13 | 1.24 | 1.00 | |||
| A549 (lung carcinoma) | 0.94 | 1.15 | 1.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg