rs415551 chr22:33756674 T>G
- Sequence
aggatgccagataatgcgaggcag[T/G]atggtggggattaggggatgggcc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) HUES64 (embryonic stem cells) GM19239 (male B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | n/a | 2.50 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1