rs41559012 chr19:45423792 G>T
- Sequence
ccgcctcccgcacctgtggtccgg[G/T]cctcacggtttcagcgccgcgagg
- ASB in cell types
- primary B-CLL cells upper lobe of left lung
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.96 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg