rs415846 chr16:3187834 T>C
- Sequence
ataggcaaatgcacctatatatca[T/C]accagcacgacattgaaaccacca
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 1.44 | -0.33 | 1.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Frontal_Cortex_BA9, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood