rs417190 chr16:84535495 C>T
- Sequence
gatctggactcctcctcatcatcc[C/T]gcctgtgttagtgccttttggatt
- ASB in cell types
- iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | -0.57 | 1.62 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), maternal transmission distortion, obesity (body mass index (bmi)), transmission distortion