rs417260 chr9:971268 T>C
- Sequence
accgactactaaaaatacaaaaat[T/C]agccaggagtagtggtgcatgcct
- ASB in cell types
- WA09 (embryonic stem cells) HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.32 | -0.21 | 1.00 | |||
| HS-SY-2(Monophasic synovial sarcoma) | 1.70 | 0.13 | 3.00 |
Items per page:
1 – 2 of 2