rs419318 chr16:73743880 A>G
- Sequence
agggggcgccatgcatctagacca[A/G]aatctatgtgaatgtgaatacagc
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SYO-1(Biphasic synovial sarcoma) | 2.19 | -1.85 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, ldl cholesterol change with statins, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio