rs420599 chr3:11846785 C>G
- Sequence
ctgagtgtggggtgggactgcaag[C/G]acacgcaaggattggggcgttggg
- ASB in cell types
- T47D (invasive ductal carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.09 | 1.49 | 2.08 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.09 | 1.17 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood