rs421211 chr5:140202188 G>A
- Sequence
gacctcaggtgattcaccctcctc[G/A]gcctcctaaagtgcagggattaca
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.20 | -0.33 | 1.46 | |||
| HCASMC (Human coronary artery smooth muscle cells) | 0.90 | -2.28 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid