rs423431 chr17:3546613 T>C
- Sequence
tgaggaaggccccccttggagaca[T/C]gtggcttctatctgtagataaagc
- ASB in cell types
- embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | -0.47 | 2.38 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid