rs425215 chr21:42286991 C>G
- Sequence
ccaatgtgtcctggtttgtggctt[C/G]atctaggaggtgtggtggcctccg
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.38 | -0.87 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area, absent or infrequent menstruation, alcoholic liver damage, anal and rectal conditions, atherosclerosis of renal artery, atrial flutter, bursitis, calculus of kidney, calculus of ureter, cancer of kidney and urinary organs, cerebral edema and compression of brain, coagulation defects, dermatophytosis / dermatomycosis, diseases of blood and blood-forming organs, endometriosis, generalized hyperhidrosis, glossitis, hemorrhagic disorder due to intrinsic circulating anticoagulants, hypocalcemia, idiopathic fibrosing alveolitis, infestation, irregular menstrual cycle/bleeding, joint effusions, mechanical complication of nervous system device, implant, and graft, nerve plexus lesions, noninfectious disorders of lymphatic channels, noninflammatory disorders of vagina, nonrheumatic aortic valve disorders, obstruction of bile duct, open wound of ear, other congenital anomalies of skin, other diseases of respiratory system, other disorders of biliary tract, other disorders of tympanic membrane, other infectious diseases, other intestinal obstruction, other specified cardiac dysrhythmias, other specified diseases of the salivary glands, other unspecified back disorders, ovarian cyst, perforation of tympanic membrane, periostitis, peripheral retinal degenerations, poisoning by agents affecting the cardiovascular system, poisoning by water, mineral, and uric acid metabolism drugs, polycythemia vera, secondary, redundant prepuce and phimosis/bxo, speech and language disorder, symptoms associated with female genital organs, symptoms involving nervous and musculoskeletal systems, torticollis, tuberculosis, urethral hypermobility/isd, urinary calculus, viral pneumonia