rs425989 chr21:29342954 T>C
- Sequence
tttttttcctttagtagtttacca[T/C]aagggaatttcctttaagtcaacc
- ASB in cell types
- monocytes from periferal blood
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | n/a | 2.69 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants), hdl cholesterol, height, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood