rs427049 chr18:22704397 C>T
- Sequence
tacttagctacgaatcaggacata[C/T]ggacgtgattttagactttggaaa
- ASB in cell types
- foreskin keratinocyte PANC1 (pancreatic ductal adenocarcinoma) thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.83 | 1.61 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.36 | -2.87 | 1.50 | |||
| thoracic aorta | -1.40 | 1.72 | 1.00 |
Items per page:
1 – 3 of 3