rs427224 chr20:44648221 C>G
- Sequence
gggccacccctgcaaccccccttt[C/G]cacttcttccagtgcccagcaggt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) stomach H929 (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.03 | 2.02 | 1.77 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, infant head circumference, prop taste detection threshold, rheumatoid arthritis, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood