rs42775 chr5:72584687 T>C
- Sequence
atgatcccatctaaggactttgta[T/C]tgagaaactaggtcaatcatcatc
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -1.91 | 1.18 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, ldl cholesterol change with statins, obesity with early age of onset (age >2), paternal transmission distortion, schizophrenia, severe diabetic retinopathy, tetrology of fallot, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal