rs428180 chr1:8218839 A>C
- Sequence
tttgaggaaaatgatgacttggtt[A/C]ttgcgtcactctgaaggtcagaca
- ASB in cell types
- macrophages CD14+ monocytes BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- STAT1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.08 | n/a | 3.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.05 | 0.46 | 1.57 | -2.71 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP ldl cholesterol, prop taste detection threshold, salmonella-induced pyroptosis, total cholesterol