rs429110 chr21:41944366 A>C
- Sequence
ccctattaaaaatacacacacaca[A/C]aaaaaattagccaggcgtggtggc
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HKC8 (kidney proximal tubule cell line) | -1.78 | 1.97 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis