rs429657 chr15:65521426 G>A
- Sequence
aataaaaaataaaagtggctcaat[G/A]tatctttactggctgaatcggtca
- ASB in cell types
- embryonic stem cells derived definitive endoderm
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cells derived definitive endoderm | 1.18 | -0.61 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Ovary, Pituitary, Thyroid