rs430191 chr5:68027724 G>A
- Sequence
gagtcagctcttcctctaagtgac[G/A]gaaataagccattctcaagtagaa
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.27 | 0.42 | 1.05 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, irritible bowel syndrome, ldl cholesterol, ldl cholesterol change with statins, lp-pla2 mass, refractive error, total cholesterol change with statins, triglycerides