rs431060 chr6:5004362 C>A
- Sequence
accccagcctggcgccggcgcata[C/A]ctcggtcaggcccctcagagggac
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | -0.16 | 1.26 | 1.00 |
Items per page:
1 – 1 of 1