rs43118 chr7:88234098 T>A
- Sequence
ggtgggtccactcccagttgtcac[T/A]atcaaaagtgtctccagatagtgt
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | 2.58 | -1.59 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Testis, Thyroid