rs4326462 chr9:36855489 T>C
- Sequence
tcctgccctcatctaagcaaacaa[T/C]gggcatgtacaaatgacccccctg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM12891 (male B- cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines) HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -4.02 | 2.74 | 1.33 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -2.85 | 2.92 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.65 | 2.29 | 1.33 | |||
| HUES64 (embryonic stem cells) | -1.32 | 1.68 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, ldl cholesterol, neuroblastoma (brain cancer), total cholesterol