rs4327001 chr15:73717960 G>A
- Sequence
gggaccccagtcctgggggagtgc[G/A]tctgcctcctagtggattatgtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.96 | -3.10 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.27 | -1.94 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.38 | -0.39 | 1.50 |
Items per page:
1 – 3 of 3