rs4329925 chr16:87828401 T>C
- Sequence
tctctgagtctccctcaagtcaca[T/C]gggaagaggtttctctgcacaagc
- ASB in cell types
- HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- PCF11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PCF11_HUMAN | -2.69 | 2.17 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, fasting blood glucose, irritible bowel syndrome, lesion load (multiple sclerosis)