rs433073 chr3:223664 G>A
- Sequence
atagggcaaattcactgagacagc[G/A]gtattacagtagagaaagagttta
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | 1.56 | -0.21 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis