rs4331454 chr2:238685833 G>A
- Sequence
tgttcaatttcaaagcatgcataa[G/A]tgtactgtattttccaacaggggg
- ASB in cell types
- HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 1.80 | -2.03 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, microalbuminuria, triglycerides, urinary albumin-to-creatinine ratio