rs4333869 chr1:99737167 G>A
- Sequence
actcttcctgctccctaggaaagc[G/A]agatgtttatgcaggcctctgctc
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM18951 (B-cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.20 | 1.57 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), college completion, major depressive disorder, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood