rs4336644 chr8:120123889 G>C
- Sequence
tccagccgcaggacccctgctgca[G/C]ctcggagcacgcgcagcaatgcaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.47 | -0.02 | 1.00 | n/a | n/a | |||
| ESR1_HUMAN | 0.00 | 1.51 | 1.36 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg