rs4337794 chr4:116703112 G>A
- Sequence
ccctctgatcttatgggtttttac[G/A]gtaattgcagcttcctgccatttg
- ASB in cell types
- SK-N-SH (neuroblastoma) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -3.54 | 2.23 | 1.33 | |||
| pancreas | 1.27 | -1.41 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, microalbuminuria, rheumatoid arthritis, total cholesterol, triglycerides