rs4341154 chr8:78393452 A>T
- Sequence
agacagtaaatatgttatattttt[A/T]aaaacttctacaatcaaattattg
- ASB in cell types
- neural cell KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.23 | 1.27 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | -0.71 | 1.48 | 1.50 |
Items per page:
1 – 2 of 2