rs4342608 chr8:26445475 A>G
- Sequence
ttctttacctctgcccaaatgagg[A/G]caaggagatgaagcgtggctgaaa
- ASB in cell types
- LNCaP (prostate carcinoma) breast tumor
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | n/a | 3.59 | 2.00 | n/a | No Hit | |||
| ANDR_HUMAN | -0.10 | 0.91 | 1.52 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, parkinsons disease, total cholesterol change with statins