rs4344373 chr1:95116044 A>T
- Sequence
accgtgtggttcaaagagcactgg[A/T]gccctggtacatcctgagagtctt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.16 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis