rs4346982 chr8:78393569 A>T
- Sequence
agcaacctactttacaccttaaaa[A/T]tacgctgtcccagacatctaaata
- ASB in cell types
- KMS-11 (Plasma cell myeloma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | -2.07 | 1.74 | 1.50 | |||
| erythroid progenitors | 2.25 | n/a | 2.50 |
Items per page:
1 – 2 of 2