rs4347630 chr16:1193557 T>C
- Sequence
aggcggcagtgcgtgctgtggcct[T/C]gcccacctatgggacagcgcgtgg
- ASB in cell types
- MKL-1 (Merkel cell carcinoma) 22RV1 (prostate carcinoma) PANC1 (pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.69 | 2.42 | 1.33 | n/a | No Hit | |||
| MAX_HUMAN | n/a | 3.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2