rs4349489 chr3:8501609 G>C
- Sequence
ttcctgccgctcgagggatagaag[G/C]gagctgggtagtcaggggccgcgg
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte HUVEC-C (HUVEC, umbilical vein endothelial cells) renal cortex
- ASB for transcription factors
- GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | 2.62 | -4.84 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hippocampus, Colon_Sigmoid, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Nerve_Tibial, Ovary, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid