rs4350821 chr20:4592878 G>C
- Sequence
ggtgtttgagggcagtgaggaaaa[G/C]gacctgtctgcagagatcgtctct
- ASB in cell types
- glioblastoma cells ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 2.39 | n/a | 2.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.42 | -2.16 | 1.00 |
Items per page:
1 – 2 of 2