rs4352210 chr2:37523837 A>G
- Sequence
tttttagctgagatattaagtctc[A/G]gtgtttaatagaatgatttgccct
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -1.80 | 2.59 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, heart rate, height, irritible bowel syndrome, late onset alzheimers disease, primary rhegmatogenous retinal detachment, rr interval
PheWAS abnormal results of function studies, acute renal failure, amblyopia, atrophy of edentulous alveolar ridge, blood vessel replaced, cancer of kidney and renal pelvis, chronic lymphocytic thyroiditis, colon cancer, colorectal cancer, complex regional/central pain syndrome, conduct disorders, congenital anomalies of urinary system, conjunctivitis, infectious, cystic kidney disease, cystoid macular degeneration of retina, disorders of mineral metabolism, epilepsy, fever of unknown origin, fracture of clavicle or scapula, fuchs dystrophy, genitourinary congenital anomalies, hereditary and idiopathic peripheral neuropathy, idiopathic fibrosing alveolitis, infection of the eye, intestinal obstruction without mention of hernia, intracerebral hemorrhage, magnesium metabolism disorder, malignant neoplasm of kidney and other urinary organs, menieres disease, microscopic hematuria, mycoses, neuralgia, neuritis, and radiculitis nos, oliguria and anuria, other alveolar and parietoalveolar pneumonopathy, other benign neoplasm of connective and other soft tissue, other cells and casts in urine, other congenital anomalies of skin, other disorders of the kidney and ureters, other endocrine disorders, other infectious diseases, other intestinal obstruction, other rheumatic heart disease, paralytic ileus, paroxysmal supraventricular tachycardia, partial epilepsy, persistent mental disorders due to other conditions, peyronies disease, polycythemia vera, secondary, postnasal drip, premenstrual tension syndromes, primary angle-closure glaucoma, renal cell carcinoma, secondary malignancy of lung, sepsis, sepsis and sirs, septicemia, spinal stenosis of lumbar region, stiffness of joint, stricture and stenosis of esophagus, thyroiditis, traumatic arthropathy, ulcerative stomatitis & mucositis, urethritis and urethral syndrome, ventral hernia, viral warts & hpv, vitamin deficiency