rs4353591 chr2:213153830 G>C
- Sequence
ttcaagagttaactttcactggct[G/C]cctagtcaccagaggcacactttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) RH4 (alveolar rhabdomyosarcoma) CD34+ stem cells-derived erythroblasts glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.82 | -1.59 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | 1.28 | -3.69 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | -0.51 | 2.44 | 2.00 | |||
| glioblastoma cells | 0.99 | -1.46 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Vagina