rs4363049 chr6:150698644 G>A
- Sequence
caaaacacaagtacctcctgtaac[G/A]caactgtaggccagacgatacata
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 2.02 | -0.50 | 1.85 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.77 | 1.75 | 1.06 | |||
| monocyte-derived dendritic cells | -4.23 | 1.86 | 2.00 |
Items per page:
1 – 3 of 3