rs4364183 chr3:18768044 G>A
- Sequence
caacaaatatttattgaatgttta[G/A]taggtgccaaatactttgctgggt
- ASB in cell types
- breast tumor xenograft primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | 3.04 | -2.83 | 1.00 | |||
| primary prostate cancer | -1.83 | 2.78 | 2.00 |
Items per page:
1 – 2 of 2