rs4364881 chr1:112804371 G>A
- Sequence
gatgggacagtgccatctagctgc[G/A]gctaggccagagcaacaacagggc
- ASB in cell types
- glioblastoma cells HEK293 (embryonic kidney) neural cell HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 0.01 | 1.20 | 1.50 | |||
| HEK293 (embryonic kidney) | 0.74 | 0.13 | 1.92 | |||
| neural cell | -0.59 | 1.67 | 1.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.24 | 0.63 | 1.33 | |||
| MDM(monocyte derived macrophages) | 1.66 | -0.87 | 2.00 |
Items per page:
1 – 5 of 5