rs4367498 chr8:128379518 A>G
- Sequence
ctggcacaagggacatggacgagg[A/G]gacagcttattgttgtttgggcag
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.29 | -4.27 | 1.50 | n/a | No Hit | |||
| RXRA_HUMAN | 2.44 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, ldl cholesterol, rheumatoid arthritis, triglycerides, urinary albumin-to-creatinine ratio, years of education