rs4371519 chr3:95457526 C>T
- Sequence
cttaggtcataattcctcaaggtt[C/T]tgatttcctaattacctggttttt
- ASB for transcription factors
- CDX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDX2_HUMAN | 1.62 | -1.28 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) (within family tests max measurement), body mass index (bmi) (within family tests), ldl cholesterol, total cholesterol