rs4374230 chr17:59618408 C>T
- Sequence
acctaaactgcttagcatacaaaa[C/T]tatcgtctacccaatagggtttta
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- EMSY_HUMAN ZN316_HUMAN ANDR_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EMSY_HUMAN | n/a | 2.79 | 2.00 | n/a | n/a | |||
| ZN316_HUMAN | -0.89 | 1.68 | 2.00 | n/a | No Hit | |||
| ANDR_HUMAN | -0.62 | 2.61 | 3.50 | n/a | No Hit | |||
| ARI1B_HUMAN | -1.94 | 2.72 | 2.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, barnes akathisia rating scale, cystatin c in serum, ldl cholesterol, refractive error, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood