rs4374386 chr2:160650726 C>T
- Sequence
taactctccatgttcatgttccaa[C/T]gcagtctgattattctcaaggcct
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.26 | 1.81 | 1.45 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), hdl cholesterol change with statins, microalbuminuria, systolic blood pressure (sbp), years of education