rs4375365 chr10:48658408 A>G
- Sequence
agaaacctggagctgattcacaaa[A/G]gtagagtaatcctgtctgcagttg
- ASB in cell types
- KMS-11 (Plasma cell myeloma) K562 (myelogenous leukemia) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | -4.15 | 1.50 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.54 | 0.79 | 1.20 | |||
| erythroid progenitors | -2.26 | 3.06 | 2.00 |
Items per page:
1 – 3 of 3