rs4376260 chr5:124704868 T>C
- Sequence
tttgtacaagtgtaataagctgtc[T/C]ctagtggcagcctaggtacacata
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.24 | 2.30 | 1.00 | 0.77 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, acute lung injury following major trauma, diastolic blood pressure (dbp), parkinsons disease, systolic blood pressure (sbp)